產(chǎn)品名稱 | Meyerozyma guilliermondii (Wickerham) Kurtzman et M. Suzuki |
---|---|
商品貨號 | B166035 |
Deposited As | Monilia guilliermondii (Castellani) Castellani et Chalmers |
Strain Designations | [ATCC 7350, CBS 566, DBVPG 6140, IFO 10279, IGC 2730, JCM 1539, NRRL Y-324] |
Application | Produces riboflavin vitamin B2 Quality control strain Quality control strain for API products |
Biosafety Level | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
Product Format | freeze-dried |
Storage Conditions | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
Type Strain | yes (type strain of Candida guilliermondii) |
Preceptrol® | yes |
Genome Sequenced Strain | Yes |
Comments | Genome sequencing strain (Broad Institute, USA). |
Morphology | On YM medium at 25°C after 4 days, colonies creamy white to dingy white, butyrous, dull, smooth, margin entire. Cells hyaline, ellipsoidal, smooth, 4-5.5 X 2.5-4 μm. Pseudohyphae not observed. |
Medium | ATCC® Medium 28: Emmons' modification of Sabouraud's agar ATCC® Medium 200: YM agar or YM broth ATCC® Medium 336: Potato dextrose agar (PDA) |
Growth Conditions | Temperature: 24°C to 26°C
Atmosphere: Typical aerobic |
Sequenced Data |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence
GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACAGTATTCTTTTGCCAGCGCTTAACTGCGCGGCGAAAAACCTTACACACAGTGTCTTTTTGATACAGAACTCTTGCTTTGGTTTGGCCTAGAGATAGGTTGGGCCAGAGGTTTAACAAAACACAATTTAATTATTTTTACAGTTAGTCAAATTTTGAATTAATCTTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATATGAATTGCAGATTTTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCAGAGGGCATGCCTGTTTGAGCGTCATTTCTCTCTCAAACCCCCGGGTTTGGTATTGAGTGATACTCTTAGTCGGACTAGGCGTTTGCTTGAAAAGTATTGGCATGGGTAGTACTGGATAGTGCTGTCGACCTCTCAATGTATTAGGTTTATCCAACTCGTTGAATGGTGTGGCGGGATATTTCTGGTATTGTTGGCCCGGCCTTACAACAACCAAACAAGCTTGACCTCAAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAA D1D2 region of the 26S ribosomal RNA gene ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGCCTTCGGTGTCCGAGTTGTAATTTGAAGATTGTAACCTTGGGGTTGGCTCTTGTCTATGTTTCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAGGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGTTTGAGATCAGACTCGATATTTTGTGAGCCTTGCCTTCGTGGCGGGGTGACCCGCAGCTTATCGGGCCAGCATCGGTTTGGGCGGTAGGATAATGGCGTAGGAATGTGACTTTACTTCGGTGAAGTGTTATAGCCTGCGTTGATGCTGCCTGCCTAGACCGAGGACTGCGATTTTATCAAGGATGCTGGCATAATGATCCCAAACCGC |
Name of Depositor | A Castellani |
Chain of Custody | ATCC <-- A Castellani |
Isolation | Sputum from patient with bronchomycosis |
Cross References | Nucleotide (GenBank) : M60304 C.guilliermondii small subunit ribosomal RNA. Nucleotide (GenBank) : AF218967 Pichia guilliermondii strain ATCC 6260T 5.8S ribosomal RNA gene Nucleotide (GenBank) : AAFM00000000 Meyerozyma guilliermondii ATCC 6260, whole genome shotgun sequencing project Nucleotide (GenBank) : KU729068 ITS including 5.8S rRNA gene Nucleotide (GenBank) : KU729151 D1/D2 region of 28S rRNA gene |
References | API 20C AUX. bioMerieux. Butler G, et al. Evolution of pathogenicity and sexual reproduction in eight Candida genomes. Nature 459: 657-662, 2009. PubMed: 19465905 Foureau E, et al. A TRP5/5-fluoroanthranilic acid counter-selection system for gene disruption in Candida guilliermondii. Curr. Genet. 58: 245-254, 2012. PubMed: 22618436 Garcia-Effron G, et al. Assessment of two new molecular methods for identification of Candida parapsilosis sensu lato species. J. Clin. Microbiol. 49: 3257-3261, 2011. PubMed: 21795509 Desnos-Ollivier M, et al. Debaryomyces hansenii (Candida famata), a rare human fungal pathogen often misidentified as Pichia guilliermondii (Candida guilliermondii). J. Clin. Microbiol. 46: 3237-3242, 2008. PubMed: 18701668 Daniel HM, Meyer W. Evaluation of ribosomal RNA and actin gene sequences for the identification of ascomycetous yeasts. Int. J. Food Microbiol. 86: 61-78, 2003. PubMed: 12892922 Sugita T, Nakase T. Non-universal usage of the leucine CUG codon and the molecular phylogeny of the genus Candida. Syst Appl Microbiol 22: 79-86, 1999. PubMed: 10188281 Suzuki M, Nakase T. Cellular neutral sugar compositions and ubiquinone systems of the genus Candida. Microbiol. Cult. Collect. 14: 49-62, 1998. Thanos M, et al. Rapid identification of Candida species by DNA fingerprinting with PCR. J Clin Microbiol 34: 615-621, 1996. PubMed: 8904425 Tanner FW Jr., et al. Riboflavin production by Candida species. Science 101: 180-181, 1945. Castellani AJ. Observations on the fungi found in tropical bronchomycosis. Lancet 1: 13-15, 1912. type strain of Candida guilliermondii |
梅經(jīng)理 | 17280875617 | 1438578920 |
胡經(jīng)理 | 13345964880 | 2438244627 |
周經(jīng)理 | 17757487661 | 1296385441 |
于經(jīng)理 | 18067160830 | 2088210172 |
沈經(jīng)理 | 19548299266 | 2662369050 |
李經(jīng)理 | 13626845108 | 972239479 |