產(chǎn)品名稱 |
Candida kefyr (Beijerinck) van Uden et Buckley |
商品貨號 |
B166037 |
Deposited As |
Candida kefyr (Beijerinck) van Uden et Buckley |
Strain Designations |
CBS 607 [ATCC 6264, ATCC 6265, ATCC 7348, CBS 1620, DBVPG 6161, JCM 3760, NCYC 6] |
Alternate State |
Kluyveromyces marxianus (EC Hansen) van der Walt |
Application |
Bacterial resistance testing Fungus resistance testing adhesives Control strain for typing systems |
Biosafety Level |
1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
Product Format |
freeze-dried |
Storage Conditions |
Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
Type Strain |
yes
(type strain of Endomyces pseudotropicalis) |
Preceptrol® |
no |
Comments |
Esterase activity |
Morphology |
On YM medium at 25°C after 6 days, colonies creamy white to dingy white, smooth to faintly wrinkled, raised, margin filamentous. Cells hyaline, smooth, ovoid to ellipsoidal, guttulate, 6-9 X 4.5 μm. Pseudohyphae abundant. |
Medium |
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 1245: YEPD
|
Growth Conditions |
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic |
Sequenced Data |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence
GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAAAGATTATGAATGAATAGATTACTGGGGGAATCGTCTGAACAAGGCCTGCGCTTAATTGCGCGGCCAGTTCTTGATTCTCTGCTATCAGTTTTCTATTTCTCATCCTAAACACAATGGAGTTTTTTCTCTATGAACTACTTCCCTGGAGAGCTCGTCTCTCCAGTGGACATAAACACAAACAATATTTTGTATTATGAAAAACTATTATACTATAAAATTTAATATTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATATGTATTGTGAATTGCAGATTTTCGTGAATCATCAAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCTCTCTCAAACCTTTGGGTTTGGTAGTGAGTGATACTCGTCTCGGGTTAACTTGAAAGTGGCTAGCCGTTGCCATCTGCGTGAGCAGGGCTGCGTGTCAAGTCTATGGACTCGACTCTTGCACATCTACGTCTTAGGTTTGCGCCAATTCGTGGTAAGCTTGGGTCATAGAGACTCATAGGTGTTATAAAGACTCGCTGGTGTTTGTCTCCTTGAGGCATACGGCTTTAACCAAAACTCTCAAAGTTTGACCTCAAATCAGGTAGGAGTAC
|
Name of Depositor |
CBS |
Isolation |
Clinical bronchomycosis, Sri Lanka |
Cross References |
Nucleotide (GenBank) :
M60303
C.kefyr small subunit ribosomal RNA.
|
References |
Rudek W. Esterase activity in Candida species. J Clin Microbiol 8: 756-759, 1978. PubMed: 370150
Castellani A. Observations on fungi of the genus Endomyces affecting man in the tropics. Centralbl. Bakteriol. Parasitenkd. Infektionskr. I Abt. 58: 236-238, 1911.
Vazquez JA, et al. Comparison of restriction enzyme analysis versus pulsed-field gradient gel electrophoresis as a typing system for Torulopsis glabrata and Candida species other than C. albicans. J Clin Microbiol 31: 2021-2030, 1993. PubMed: 8396585
ASTM International Standard Test Methods for Resistance of Adhesive Preparations in Container to Attack by Bacteria, Yeast, and Fungi. West Conshohocken, PA:ASTM International;ASTM Standard Test Method D 4783-01e1.
Thanos M, et al. Rapid identification of Candida species by DNA fingerprinting with PCR. J Clin Microbiol 34: 615-621, 1996. PubMed: 8904425
Kato M, et al. Phylogenetic relationship and mode of evolution of yeast DNA topoisomerase II gene in the pathogenic Candida species. Gene 272: 275-281, 2001. PubMed: 11470534
type strain of Endomyces pseudotropicalis
|