| 產(chǎn)品名稱 | Candida utilis (Henneberg) Lodder et Kreger-van Rij |
|---|---|
| 商品貨號 | B166160 |
| Deposited As | Torulopsis utilis (Henneberg) Lodder |
| Strain Designations | NRRL Y-900 [CBS 5609, CCRC 20325, DSM 2361, IFO 0988, NBRC 0988, NCYC 707, NRCC 2721, VTT C-78085] |
| Alternate State | Cyberlindnera jadinii (Sartory et al.) Minter, teleomorph |
| Application | Accumulates zinc
Assay of antimicrobial agent
Degrades RNA ribonucleic acid
Degrades alfalfa process wastes
Degrades ethyl alcohol ethanol
Degrades pickle process brine
Degrades potato wastes
Degrades rapeseed oil meal
Degrades sauerkraut brine
Produces S-adenosylmethionine
Produces acetaldehyde
Produces ethyl acetate
Produces methionine adenosyltransferase S-adenosylmethionine synthetase
Produces single-cell protein SCP
Quality control strain
Transformation host
Transformation host for expression of carotenogenic genes
Used in Controlled Ecological Life Support Systems (CELSS) for food
Produces adenosyl-D-methionine and adenosyl-2-methylmethionine
Conversion of 5'-methylthioadenosine into S-adenosylmethionine |
| Biosafety Level | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format | freeze-dried |
| Storage Conditions | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain | no |
| Preceptrol® | no |
| Genome Sequenced Strain | Yes |
| Comments | Cell vacuoles
Genome sequencing strain (KIRIN Holdings Company, Japan) |
| Medium | ATCC® Medium 200: YM agar or YM broth ATCC® Medium 1245: YEPD ATCC® Medium 28: Emmons' modification of Sabouraud's agar |
| Growth Conditions | Temperature: 25°C to 30°C
Atmosphere: Typical aerobic |
| Sequenced Data |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence GCGCTTCTAGCGCGGCTCCACCAATACACAGTGTATTTTGCTTCTTTTGCTTTGGCTCTGCCAAAGGTTTTTAAACACAGAAATTTATTTTCTCTAGAAACTAGTCAATTTGAATTTTAATCTTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCAACGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGGTTTTCGTGAATCATCGAATCTTTGAACGCATATTGCGCTCTCTGGCATTCCAGAGAGCATGCCTGTTTGAGCGTCATTTCTCTCTCAAGATCCTCTAGGGGACTTGGTATTGAGTGATACTCTGTGTTAACTTGAAATACTCTAGGCAGAGCTCCCCCTAGAAATCCTCTGGGCCGAAATAATGTATTAGGTTCTACCAACTCGTTATTTTCCAGACAGACTTCCAGGCAGAGCTCGGC D1D2 region of the 26S ribosomal RNA gene ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGAGGCTYTCAGCCCCCGAGTTGTAATTTGAAGATGGTGTTCTGGTGCCGGCCCCCTGTCTACGTTCCTTGGAACAGGACATCACAGAGGGTGAGAATCCCGTCTGGCGGGGCGGCCTGGCTCCGTGTAGAGCGCCATCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGTATTGGATCAGACTTGGTGCTGTGCGAATAGCGGCYCTTCTTGGGCYGCCCACTCGCACTCCACCGGGCCAGCATCGGTTTGGGCGGCAAGACAATGGCGGSGGAACGTGGCACTGCTCTCGGGCAGTGTGTTTATAGCCCCCGCTGATGTTGCCTGCCTAGACCGAGGACTGCGGCTTCTGCCTAGGATGCTGGCGTAATGATCCAACACCGC |
| Name of Depositor | NRRL |
| Cross References | Nucleotide (GenBank) : AJ277098 Candida utilis anc gene for mitochondrial ADP/ATP carrier, isoform Nucleotide (GenBank) : AJ277099 Candida utilis anc gene for mitochondrial ADP/ATP carrier, isoform Nucleotide (GenBank) : BAEL00000000 Cyberlindnera jadinii NBRC 0988 strain NBRC0988, whole genome shotgun sequencing project |
| References | Tamakawa H, Ikushima S, Yoshida S. Construction of a Candida utilis strain with ratio-optimized expression of xylose-metabolizing enzyme genes by cocktail multicopy integration method. J Biosci Bioeng 115: 532-539, 2013. PubMed: 23294574 Tamakawa H, et al. Metabolomic and transcriptomic analysis for rate-limiting metabolic steps in xylose utilization by recombinant Candida utilis. Biosci Biotechnol Biochem 77: 1441-1448, 2013. PubMed: 23832335 Tomita Y, et al. Genome and transcriptome analysis of the food-yeast Candida utilis. PLoS One 7: e37226, 2012. PubMed: 22629373 Suzuki T, et al. Identification and characterization of genes involved in glutathione production in yeast. J Biosci Bioeng 112: 107-113, 2011. PubMed: 21601516 Ostermann K, et al. Identification of the genes GPD1 and GPD2 of Pichia jadinii. DNA Seq 17: 452-457, 2006. PubMed: 17381046 Park YC, et al. Molecular cloning and characterization of the alcohol dehydrogenase ADH1 gene of Candida utilis ATCC 9950. J Ind Microbiol Biotechnol 33: 1032-1036, 2006. PubMed: 16855819 Miura Y, et al. Production of the carotenoids lycopene, beta-carotene, and astaxanthin in the food yeast Candida utilis. Appl. Environ. Microbiol. 64: 1226-1229, 1998. PubMed: 9546156 Kondo K, et al. A transformation system for the yeast Candida utilis: use of a modified endogenous ribosomal protein gene as a drug-resistant marker and ribosomal DNA as an integration target for vector DNA. J. Bacteriol. 177: 7171-7177, 1995. PubMed: 8522525 Peterson GR. Reproducible analyses of microbial food for advanced life support systems. Enzyme Microb. Technol. 10: 586-592, 1988. Armstrong DW, et al. Production of ethyl acetate from dilute ethanol solutions by Candida utilis. Biotechnol. Bioeng. 26: 1038-1041, 1984. Armstrong DW, et al. Production of acetaldehyde from ethanol by Candida utilis. Biotechnol. Lett. 6: 183-188, 1984. Lawford HG, et al. Hyperaccumulation of zinc-depleted Candida utilis grown in chemostat culture. Can. J. Microbiol. 26: 71-76, 1980. PubMed: 7190863 Mudgett RE, et al. Single cell protein recovery from alfalfa process wastes. Trans. ASAE 23: 1590-1594, 1980. Shapiro SK, Schlenk F. Conversion of 5'-methylthioadenosine into S-adenosylmethionine by yeast cells. Biochim. Biophys. Acta 633: 176-180, 1980. PubMed: 7193054 Lawford GR, et al. Production of high-quality edible protein from Candida yeast grown in continuous culture. Biotechnol. Bioeng. 21: 1163-1174, 1979. Phillipchuk GE, Jackson H. Rapeseed oil meal as a nitrogenous substrate for microbial fermentation. J. Gen. Appl. Microbiol. 25: 117-125, 1979. Stevenson KE, et al. Aerobic fermentations of pickle process brine by Candida utilis. J. Food Sci. 44: 181-185, 1979. Schlenk F, et al. Biosynthesis of adenosyl-D-methionine and adenosyl-2-methylmethionine by Candida utilis. Arch. Biochem. Biophys. 187: 191-196, 1978. PubMed: 566086 Moreton RS. Growth of Candida utilis on enzymatically hydrolyzed potato waste. J. Appl. Bacteriol. 44: 373-382, 1978. Riviere J, et al. Production de proteines microbiennes a partir de mouture de ble. Ann. Technol. Agric. 27: 585-607, 1978. Irgens RL, Clarke JD. Production of single-cell protein by the cultivation of yeast in anaerobic digester supernatant supplemented with carbohydrates. Eur. J. Appl. Microbiol. 2: 231-241, 1976. Holcomb ER, Shapiro SK. Assay and regulation of S-adenosylmethionine synthetase in Saccharomyces cerevisiae and Candida utilis. J. Bacteriol. 121: 267-271, 1975. PubMed: 1090572 Brewer D, et al. The antibiotic activity of cultures from fungal spores collected by a spore trap on permanent pasture. Can. J. Microbiol. 20: 721-729, 1974. PubMed: 4857622 Nakamura KD, Schlenk F. Examination of isolated yeast cell vacuoles for active transport. J. Bacteriol. 118: 314-316, 1974. PubMed: 4362463 Hang YD, et al. Sauerkraut waste: a favorable medium for cultivating yeasts. Appl. Microbiol. 24: 1007-1008, 1972. . . Trans. ASAE 14: 103-122, 1972. Ohta S, et al. Characterization of a heat-shock process for reduction of the nucleic acid content of Candida utilis. Appl. Microbiol. 22: 415-421, 1971. PubMed: 4330316 Maul SB, et al. New process for reducing the nucleic acid content of yeast. Nature 228: 181, 1970. PubMed: 5460024 Reiser CO. Torula yeast from potato starch wastes. J. Agric. Food Chem. 2: 70-74, 1954. VITEK 2 YST Comprehensive QC Set. bioMerieux. |
| 梅經(jīng)理 | 17280875617 | 1438578920 |
| 胡經(jīng)理 | 13345964880 | 2438244627 |
| 周經(jīng)理 | 17757487661 | 1296385441 |
| 于經(jīng)理 | 18067160830 | 2088210172 |
| 沈經(jīng)理 | 19548299266 | 2662369050 |
| 李經(jīng)理 | 13626845108 | 972239479 |
