| 產(chǎn)品名稱 |
HHCPQ06 |
| 商品貨號(hào) |
B225649 |
| Designations |
HHCPQ06 |
| GenBank Number |
M78198
|
| Species |
Homo sapiens, human |
| Applications |
The predicted product size is (bp): 117. The observed product size(s) is(are) (bp): 117 (human). |
| Vector |
Construct size (kb): 4.300000190734863 DESCRIPTION OF VECTOR COMPONENT:
Name of vector: pBluescript SK-
Intact vector size: 2.960
Type of vector: phagemid
Vector end: EcoRI
Vector end: EcoRI
Cloning sites: KpnI ApaI DraII XhoI (SalI HincII AccI) ClaI HindIII EcoRV
EcoRI PstI SmaI BamHI SpeI XbaI EagI NotI SacII BstXI SacI
Polylinker sites: SacI BstXI SacII NotI EagI XbaI SpeI BamHI SmaI PstI EcoRI
EcoRV HindIII (ClaI Bsp106I) (HincII AccI SalI) XhoI
(Eco0109I DraII ApaI) KpnI
Construction: pUC19
Host range: Escherichia coli
Features (with orientation and position when available):
replicon: f1, ->
insert detection: lacZ', <-
primer site: M13-20, ->
promoter: T7, ->
MCS: KpnI...SacI, ->
promoter: T3, <-
promoter: lac, <-
primer site: M13 reverse, <-
replicon: pMB1
marker(s): ampR, <-
Cross references: |
| Insert |
DNA: cDNA DESCRIPTION OF INSERT COMPONENT:
Genome: Homo sapiens
Gene symbol: D19S387E
Genomic copy number: unique
Gene name: DNA Segment, single copy, expressed
Contains complete coding sequence?: U
Sequence homology: Homo sapiens inositol 1,4,5-trisphosphate 3-kinase
Chromosome: 19; Localization: 19 q13.1-q13.2
Tissue: hippocampus, female, 2 years, oligo-dT and random primed
(Stratagene 936205), subtracted
Type of DNA: cDNA
Insert end: Modification: EcoRI linkers
Insert end: Modification: EcoRI linkers
Insert size (kb): 1.1
Cross references: DNA Seq. Acc.: M78198; EST: EST01791; Primer: M13 Forward;
THC id: THC98332 Insert lengths(kb): 1.100000023841858 Tissue: hippocampus, female, 2 years, oligo-dT and random primed (Stratagene 936205), subtracted Gene product: inositol 1,4,5-trisphosphate 3-kinase [ITPK*] |
| Insert Size (kb) |
1.100 |
| Biosafety Level |
1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Shipping Information |
Distributed: DNA (dried). Rehydrate with TE. (amount: 200 ng) |
| Comments |
Restriction digests of the clone give the following sizes (kb): EcoRI--3.2, 1.1; BamHI--4.3; PvuII--2.7, 1.1, 0.5. EST01791 can be detected in genomic DNA using the following oligonucleotides (5'-3'): GTGGCACATGACACAATCTC and CAGGTTAATTGGATGGCG. EST01791 matches PIR accession JN0129 with 68.18% identity and 80.29% similarity over the sequence range: 348-151. Appears to be chimeric, with the chromosome 19-specific portion showing homology to ITP3. This sequence record is for human inositol 1,4,5-trisphosphate 3-kinase. The predicted product size is (bp): 117. The observed product size(s) is(are) (bp): 117 (human). |
| References |
Korenberg JR, et al. Toward a cDNA map of the human genome. Genomics 29: 364-370, 1995. PubMed: 8666383
Adams MD, et al. Sequence identification of 2,375 human brain genes. Nature 355: 632-634, 1992. PubMed: 1538749
Maglott DR, et al259 human brain expressed sequence tags (ESTs): chromosome localization, subregional assignment, and sequence analysisIn: Maglott DR, et alIdentification of transcribed sequencesNew YorkPlenum Presspp. 273-288, 1994
Gregory G Lennon, personal communication
J C Venter, personal communication
|
